HUGE

Gene/Protein Characteristic Table for KIAA0381

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00063
Accession No. :	AB002379
Description :	Disheveled-associated activator of morphogenesis 2.
HUGO Gene Name :	dishevelled associated activator of morphogenesis 2 (DAAM2)
Clone Name :	ah04695 [Vector Info]
Flexi ORF Clone :	pF1KA0381
Source :	Human brain (amygdala)
Note :	We replaced hh00540, former representative clones for KIAA0381 with ah04695. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6177 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2831 bp

Genome contig ID gi89161210f_39768137
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TACTAAAAAATATTAAATTCATACCATCCCTACCC
Flanking genome sequence
(212487 - 212536)
----+----*----+----*----+----*----+----*----+----*
AGTCTGCCTTTAAACTTGTGCCTTCTTCCTATGAGGGGATCTGGGGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 39868137 39980622 25 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001113947	99.1	dishevelled ass...	Macaca mulatta
Q86T65	100.0	Disheveled-asso...	Homo sapiens
EAX03996	99.9	dishevelled ass...	Homo sapiens
XP_518453	97.4	dishevelled ass...	Pan troglodytes
CAD89973	99.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014566	1.3e-71	67.7	KIAA0666
AB067489	2.2e-16	26.7	KIAA1902
AB095934	4.7e-16	26.8	KIAA2014
AB051482	1.1e-07	26.1	KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010473 86 275 PF06371 Diaphanous GTPase-binding

IPR010472 277 483 PF06367 Diaphanous FH3

IPR015425 642 1015 PF02181 Actin-binding FH2

HMMSmart IPR003104 641 1084 SM00498 Actin-binding FH2 and DRF autoregulatory

ProfileScan IPR014768 86 462 PS51232 GTPase-binding/formin homology 3

IPR014767 1062 1094 PS51231 Diaphanous autoregulatory

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010473	86	275	PF06371	Diaphanous GTPase-binding
IPR010472	277	483	PF06367	Diaphanous FH3
IPR015425	642	1015	PF02181	Actin-binding FH2
HMMSmart	IPR003104	641	1084	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	86	462	PS51232	GTPase-binding/formin homology 3
IPR014767	1062	1094	PS51231	Diaphanous autoregulatory

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAGGTGCAAGTGAAAAAGGAC

Primer_r
: ATCTCCCCCGACTTCTACCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGGTGCAAGTGAAAAAGGAC
Primer_r	: ATCTCCCCCGACTTCTACCAG
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2831 bp
Genome contig ID	gi89161210f_39768137
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TACTAAAAAATATTAAATTCATACCATCCCTACCC
Flanking genome sequence (212487 - 212536)	----+--------+--------+--------+--------+----* AGTCTGCCTTTAAACTTGTGCCTTCTTCCTATGAGGGGATCTGGGGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	39868137	39980622	25	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0381

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information