HUGE

Gene/Protein Characteristic Table for KIAA0310

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00048
Accession No. :	AB002308
Description :
HUGO Gene Name :
Clone Name :	ee03470 [Vector Info]
Flexi ORF Clone :	pF1KA0310
Source :
Note :	We replaced hg00111 and hg00111s1, former representative clones for KIAA0310 with ee03470. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9031 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1648 bp

Genome contig ID gi89161216r_138354380
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGCAAATTGTTGAATAAAATATTTTGCGCTCCTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCACCTTCACCTGTGGTTCCCTTTGGTTTGCTGGAAGCGAGTGAGTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 138454380 138497328 32 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15027	100.0	Protein transpo...	Homo sapiens
CAI13952	97.9	SEC16 homolog A...	Homo sapiens
ABI78944	98.9	SEC16L [Homo sa...	Homo sapiens
AAI25019	96.6	SEC16A protein ...	Homo sapiens
EAW88236	100.0	hCG2022352, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067515	1.3e-27	36.3	KIAA1928

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAATCAAAAGTCGTGGCAGTC

Primer_r
: TCCATTTGTCCTTGTCACTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAATCAAAAGTCGTGGCAGTC
Primer_r	: TCCATTTGTCCTTGTCACTTG
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1648 bp
Genome contig ID	gi89161216r_138354380
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCAAATTGTTGAATAAAATATTTTGCGCTCCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCACCTTCACCTGTGGTTCCCTTTGGTTTGCTGGAAGCGAGTGAGTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	138454380	138497328	32	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0310

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information