| HUGE |
Gene/Protein Characteristic Table for KIAA0164 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00033 |
|---|---|
| Accession No. : | D79986 |
| Description : | Bcl-2-associated transcription factor 1. |
| HUGO Gene Name : | BCL2-associated transcription factor 1 (BCLAF1) |
| Clone Name : | ha02373 [Vector Info] |
| Flexi ORF Clone : | pF1KA0164
![]() |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5538 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2522 bp Genome contig ID gi89161210r_136521419 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AAATTGTCATACGCCAATAAAATGTCACAAGTAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTGCTGTTGTTTGTTTACCTGTGTCTATTTCACACATCTTATTTCTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 136621419 136652682 13 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 929 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : Stanford G3 | |
| : AATAACTCACTGATACCTGCG | |
| : ACACACCTAAAGAGTCATGGC | |
| : 129 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |