HUGE

Gene/Protein Characteristic Table for KIAA0151

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00030
Accession No. :	D63485
Description :	Inhibitor of nuclear factor kappa-B kinase subunit epsilon.
HUGO Gene Name :	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon (IKBKE)
Clone Name :	ha03241 [Vector Info]
Flexi ORF Clone :	pF1KA0151
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3221 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 744 bp

Genome contig ID gi89161185f_204610461
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
CAAGAAGTGGAATAAATGTGGCCTTTGCTTCTGTT
Flanking genome sequence
(126386 - 126435)
----+----*----+----*----+----*----+----*----+----*
TCTGGTGGCTCTCCCTGGGCTGTGTCTGCAAGGCAGGGCTCTCAGCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 204710461 204736845 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14164	100.0	Inhibitor of nu...	Homo sapiens
AAQ02507	100.0	inhibitor of ka...	synthetic construct
AAI05925	99.9	IKK-related kin...	Homo sapiens
XP_001088252	97.3	IKK-related kin...	Macaca mulatta
XP_001915500	89.8	similar to Inhi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018265	5e-14	31.0	KIAA0722
AB014523	5.7e-14	31.7	KIAA0623
AB011123	3.2e-11	29.4	KIAA0551
D86959	1.4e-10	29.2	KIAA0204
D86968	1.4e-10	29.0	KIAA0213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 22 228 PD000001 Protein kinase

HMMPfam IPR000719 16 228 PF00069 Protein kinase

HMMSmart IPR001245 16 332 SM00219 Tyrosine protein kinase

IPR002290 16 318 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 16 322 PS50011 Protein kinase

ScanRegExp IPR000719 22 45 PS00107 Protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	22	228	PD000001	Protein kinase
HMMPfam	IPR000719	16	228	PF00069	Protein kinase
HMMSmart	IPR001245	16	332	SM00219	Tyrosine protein kinase
IPR002290	16	318	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	16	322	PS50011	Protein kinase
ScanRegExp	IPR000719	22	45	PS00107	Protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTCTCATACGCCTTCCCACTC
Primer_r	: TCGTTTGACCTACTGCCCTGG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	744 bp
Genome contig ID	gi89161185f_204610461
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CAAGAAGTGGAATAAATGTGGCCTTTGCTTCTGTT
Flanking genome sequence (126386 - 126435)	----+--------+--------+--------+--------+----* TCTGGTGGCTCTCCCTGGGCTGTGTCTGCAAGGCAGGGCTCTCAGCTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	204710461	204736845	22	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0151

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information