HUGE

Gene/Protein Characteristic Table for KIAA0143

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00027
Accession No. :	D63477
Description :	Protein EFR3-like.
HUGO Gene Name :	EFR3 homolog A (S. cerevisiae) (EFR3A)
Clone Name :	ha03871 [Vector Info]
Flexi ORF Clone :	pF1KA0143
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5286 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2627 bp

Genome contig ID gi51511724f_132885549
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTATTAAATGCAATAAAGTTAGTTTTTGAAATGT
Flanking genome sequence
(209404 - 209453)
----+----*----+----*----+----*----+----*----+----*
AAAAATTCACTGTGCAATTCATATGTCAGCAATAAAACATAGATTATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 132985549 133094951 23 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH71611	99.8	EFR3A protein [...	Homo sapiens
Q14156	100.0	Protein EFR3 ho...	Homo sapiens
XP_001499008	98.5	similar to Prot...	Equus caballus
EDM16167	97.6	similar to RIKE...	Rattus norvegicus
Q8BG67	97.1	Protein EFR3 ho...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023170	1.2e-157	60.0	KIAA0953

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GGAAACGATAATAGGACAAGC
Primer_r	: TCAAGAGGCAAAGTTCCAGTG
PCR product length	: 230 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2627 bp
Genome contig ID	gi51511724f_132885549
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTATTAAATGCAATAAAGTTAGTTTTTGAAATGT
Flanking genome sequence (209404 - 209453)	----+--------+--------+--------+--------+----* AAAAATTCACTGTGCAATTCATATGTCAGCAATAAAACATAGATTATTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	132985549	133094951	23	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0143

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information