| HUGE |
Gene/Protein Characteristic Table for KIAA0130 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05962 |
|---|---|
| Accession No. : | D50920 |
| Description : | Thyroid hormone receptor-associated protein complex 100 kDa component. |
| HUGO Gene Name : | mediator complex subunit 24 (MED24) |
| Clone Name : | ha01208 [Vector Info] |
| Flexi ORF Clone : | pF1KA0130
![]() |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3468 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 425 bp Genome contig ID gi51511734r_35328881 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GTTCATGTATAAATAAAGCTCCTCGTGGCTCCCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGTGACTGTGTGTGCTGTTGGTATTGGTGCCACCCGGGGCAGGGCATAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 35428881 35464175 26 99.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1006 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : Genebridge 4 | |
| : TCCTGCTCATCTCCTCCATCC | |
| : GACACCTTCACCAGTTCCGAC | |
| : 163 (0.3k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |