HUGE

Gene/Protein Characteristic Table for KIAA0104

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01959
Accession No. :	D14660
Description :	39S ribosomal protein L19, mitochondrial precursor.
HUGO Gene Name :	mitochondrial ribosomal protein L19 (MRPL19)
Clone Name :	ha00685 [Vector Info]
Flexi ORF Clone :	pF1KA0104
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1322 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 445 bp

Genome contig ID gi89161199f_75627444
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATGTAGGAATGTTAAGAAATAAAACATTTAATAAG
Flanking genome sequence
(108922 - 108971)
----+----*----+----*----+----*----+----*----+----*
ATCTCAGAAGACTCCAGTAAATCTGCAATTGTATCTCTCTCCTTTTTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 75727444 75736364 6 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P49406	6.8e-113	100.0	39S ribosomal p...	Homo sapiens
XP_515568	1.2e-112	99.7	mitochondrial r...	Pan troglodytes
Q5R8M4	6.8e-107	96.2	39S ribosomal p...	Pongo abelii
XP_001112069	7.9e-105	93.5	mitochondrial r...	Macaca mulatta
XP_001498647	4.6e-93	84.2	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001857 108 191 PD002979 Ribosomal protein L19

FPrintScan IPR001857 123 152 PR00061 Ribosomal protein L19

IPR001857 153 176 PR00061 Ribosomal protein L19

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001857	108	191	PD002979	Ribosomal protein L19
FPrintScan	IPR001857	123	152	PR00061	Ribosomal protein L19
IPR001857	153	176	PR00061	Ribosomal protein L19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ATACTTACGAGATGCCCTTCC
Primer_r	: TTAGACCAGGGCTTAGGCTTC
PCR product length	: 129 (0.3k) bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	445 bp
Genome contig ID	gi89161199f_75627444
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGTAGGAATGTTAAGAAATAAAACATTTAATAAG
Flanking genome sequence (108922 - 108971)	----+--------+--------+--------+--------+----* ATCTCAGAAGACTCCAGTAAATCTGCAATTGTATCTCTCTCCTTTTTAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	75727444	75736364	6	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0104

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information