HUGE

Gene/Protein Characteristic Table for KIAA0060

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00008
Accession No. :	D31766
Description :	Glucosamine-6-phosphate isomerase.
HUGO Gene Name :	glucosamine-6-phosphate deaminase 1 (GNPDA1)
Clone Name :	ha01541 [Vector Info]
Flexi ORF Clone :	pF1KA0060
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2613 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1342 bp

Genome contig ID gi51511721r_141260427
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
ACAATGTGATATTTTCTATTAAATCCAGTATTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAAATAACATGTCATTTGTGGATTTGAGCCCCCAATTTTAGAAGACTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 141360427 141372722 8 98.8 Perfect prediction

Features of the protein sequence	Description

Length: 317 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P46926	3.3e-125	100.0	Glucosamine-6-p...	Homo sapiens
BAF83375	8.6e-125	99.7	unnamed protein...	Homo sapiens
Q5R8T8	8.6e-125	99.7	Glucosamine-6-p...	Pongo abelii
A4FV08	2.9e-123	97.9	Glucosamine-6-p...	Bos taurus
XP_001504008	1e-122	97.9	similar to gluc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006148 43 278 PF01182 Glucosamine/galactosamine-6-phosphate isomerase

HMMTigr IPR004547 29 287 TIGR00502 Glucosamine-6-phosphate isomerase

ScanRegExp IPR004547 153 171 PS01161 Glucosamine-6-phosphate isomerase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006148	43	278	PF01182	Glucosamine/galactosamine-6-phosphate isomerase
HMMTigr	IPR004547	29	287	TIGR00502	Glucosamine-6-phosphate isomerase
ScanRegExp	IPR004547	153	171	PS01161	Glucosamine-6-phosphate isomerase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TCCTTACACGCACTGATTTTC
Primer_r	: CTGTGAAAGTGGAAGAAGGAA
PCR product length	: 228 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1342 bp
Genome contig ID	gi51511721r_141260427
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- ACAATGTGATATTTTCTATTAAATCCAGTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAAATAACATGTCATTTGTGGATTTGAGCCCCCAATTTTAGAAGACTCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	141360427	141372722	8	98.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0060

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information