HUGE

Gene/Protein Characteristic Table for KIAA0044

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01954
Accession No. :	D26445
Description :	Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform.
HUGO Gene Name :
Clone Name :	ha00492 [Vector Info]
Flexi ORF Clone :	pF1KA0044
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3702 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2247 bp

Genome contig ID gi51511730f_101246036
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ACATTGGAAATAAACCGGTGACTGTTTTTCTTCAT
Flanking genome sequence
(217575 - 217624)
----+----*----+----*----+----*----+----*----+----*
AAAGTTCTGCGTTTGGCATCTTCACTCTTTCCAAAATGTATCTGTACATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 101346036 101463609 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW81755	2.2e-202	100.0	protein phospha...	Homo sapiens
XP_001489084	1.4e-199	98.8	protein phospha...	Equus caballus
XP_537555	8.3e-199	98.6	similar to gamm...	Canis lupus fam...
BAG72712	2e-198	100.0	protein phospha...	synthetic construct
AAL14778	9e-198	99.8	PP2A B56 gamma ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002554 25 437 PF01603 Protein phosphatase 2A

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002554	25	437	PF01603	Protein phosphatase 2A

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACCCCGTTCCGTAGGCAATAA
Primer_r	: GTGCTTTCCTATCGCTCTGAC
PCR product length	: 183 bp
PCR conditions	: 95 °C15 sec63 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2247 bp
Genome contig ID	gi51511730f_101246036
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACATTGGAAATAAACCGGTGACTGTTTTTCTTCAT
Flanking genome sequence (217575 - 217624)	----+--------+--------+--------+--------+----* AAAGTTCTGCGTTTGGCATCTTCACTCTTTCCAAAATGTATCTGTACATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	101346036	101463609	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0044

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information