KIAA0770

Product ID	ORK00631
Accession No	AB018313
Description	vacuolar protein sorting 39 homolog (S. cerevisiae), transcript variant 2
Clone name	hk05040s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4793 bp) Predicted protein sequence (913 aa)
HaloTag ORF Clone	FHC00631
Flexi ORF Clone	FXC00631
Source	Human adult brain
Rouge ID	mKIAA0770 by Kazusa Mouse cDNA Project
Note	We replaced hk05040, former representative clones for KIAA0770 with hk05040s1. (2002/5/10)

Length: 4793 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2041 bp
Genome contig ID	gi51511731r_40138203
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- ATCACTGCTCCTTATAATAAACCTAATAAAGCAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCAAGCCTATCTGGGTCTCTTATTTCTCCCTCCCGTGGAGTTTGATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	40238203	40287767	25	100.0	Perfect prediction

Length: 913 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAQ05978	100.0	VPS39 [Homo sap...	Homo sapiens
CAD97646	99.8	hypothetical pr...	Homo sapiens
CAH91357	99.5	hypothetical pr...	Pongo abelii
XP_001103143	99.4	vacuolar protei...	Macaca mulatta
CAL37416	99.7	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001180	53	321	PF00780	Citron-like
HMMSmart	IPR001180	48	327	SM00036	Citron-like

Primer_f	TTGACCTGCCATGTGTGCCCT
Primer_r	CATCTCCAGCCTTCTCCATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-