KIAA0594

Product ID	ORK06903
Accession No	AB011166
Description	structural maintenance of chromosomes 5
Clone name	hj02896s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5906 bp) Predicted protein sequence (1120 aa)
Source	Human adult brain
Rouge ID	mKIAA0594 by Kazusa Mouse cDNA Project
Note	We replaced hj02896, former representative clones for KIAA0594 with hj02896s1. (2002/5/10)

Length: 5906 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2542 bp
Genome contig ID	gi89161216f_71963757
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCTTTGTTGGTAATAAATCAATATTTTTATATTC
Flanking genome sequence (195854 - 195903)	----+--------+--------+--------+--------+----* TTTTGGTGTATGTTATTTTAAGTGAGAACTATTTTTTATACTCTGAACCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	72063757	72159609	25	99.5	Perfect prediction

Length: 1120 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_520066	99.5	SMC5 protein [P...	Pan troglodytes
AAH38225	100.0	Structural main...	Homo sapiens
Q8IY18	99.9	Structural main...	Homo sapiens
CAC39247	99.9	SMC5 protein [H...	Homo sapiens
Q8CG46	89.6	Structural main...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018346	0.00023	20.9	KIAA0803

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003395	71	1099	PF02463	SMC protein

Primer_f	ATACCCGCAAAATGATAGAGG
Primer_r	ACAATATGATCGTCCACACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGTCCTAGTTTCTCCCAATG
Primer_r	CTGCTACCATTTTTGAACCCC
PCR product length	238 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles