KIAA0017

Product ID	ORK00365
Accession No	D87686
Description	splicing factor 3b, subunit 3, 130kDa
Clone name	ha02425
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4294 bp) Predicted protein sequence (1253 aa)
HaloTag ORF Clone	FHC00365
Flexi ORF Clone	FXC00365
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0017 by Kazusa Mouse cDNA Project

Length: 4294 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	484 bp
Genome contig ID	gi51511732f_69015247
PolyA signal sequence (AATAGA,-24)	+--------+--------+----*----+---- ATCTAACCAGAAATAGAAACCTAGTTTTTAAGGTG
Flanking genome sequence (148456 - 148505)	----+--------+--------+--------+--------+----* ACTGGCATCCATGTGTCTTGTTCTGGAGATGAGGATGTAGGTGGGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	69115247	69163701	26	99.9	Perfect prediction

Length: 1253 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15393	100.0	Splicing factor...	Homo sapiens
XP_536791	99.9	similar to spli...	Canis lupus fam...
BAF84457	99.9	unnamed protein...	Homo sapiens
Q921M3	99.9	Splicing factor...	Mus musculus
AAH68974	99.9	Splicing factor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004871	896	1195	PF03178	CPSF A subunit
ScanRegExp	IPR003006	323	329	PS00290	Immunoglobulin/major histocompatibility complex motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GGAATCAGGAGTTGTCACCA
Primer_r	AAACCACAGGAGTCAATCAG
PCR product length	124 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles