| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00394 | 
|---|---|
| Accession No | D31885 | 
| Description | ADP-ribosylation factor-like 6 interacting protein 1 | 
| Clone name | ha01508 | 
| Vector information | |
| cDNA sequence | DNA sequence (2272 bp) Predicted protein sequence (226 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00394
     
     
     | 
| Flexi ORF Clone | FXC00394 | 
| Source | Myeloblast cell line (KG-1) | 
| Rouge ID | 
    mKIAA0069
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 2272 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 1591 bp | 
|---|---|
| Genome contig ID | gi51511732r_18610517 | 
| PolyA signal sequence (AATAAA,-29)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (99967 - 99918)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 16 | r | 18710484 | 18720358 | 6 | 99.2 | Perfect prediction | 
 
        Length: 226 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| BlastProDom | NULL | 42 | 214 | PD352110 | NULL | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | VRVSVGGLVGEVACACRDCIPET | 23 | SECONDARY | 23 | 2 | 65 | AWFPPAIMGVVSLVFLIIYYLDP | 87 | PRIMARY | 23 | 3 | 93 | VSCFVMFLCLADYLVPILAPRIF | 115 | PRIMARY | 23 | 4 | 160 | YFMTMIVSLAAVAWVGQQVHNLL | 182 | PRIMARY | 23 | 5 | 184 | TYLIVTSLLLLPGLNQHGIILKY | 206 | PRIMARY | 23 | 
|---|
 Chromosome No. 16
 Experimental conditions| Panel name | Stanford G3 | 
|---|---|
| Primer_f | GCAGACTTGAGGTGATGATAG | 
| Primer_r | CAATGGGCACCACTGTTCACA | 
| PCR product length | 181 bp | 
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |