Order Kazusa clone(s) from : ![]() |
Product ID | ORK05582 |
---|---|
Accession No | D42038 |
Description | Uncharacterized protein KIAA0087. |
Clone name | ha01002 |
Vector information | |
cDNA sequence | DNA sequence (4283 bp) Predicted protein sequence (165 aa) |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3632 bp |
---|---|
Genome contig ID | gi89161213r_26439265 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 26539265 | 26544932 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | CTCCGTTTCTTCCTTCCTTTG |
Primer_r | TAACAATCTCCCACTACGGTC |
PCR product length | 465 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |