KIAA1293

Product ID	ORK00799
Accession No	D14697
Description	farnesyl diphosphate synthase, transcript variant 1
Clone name	ha00701
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1430 bp) Predicted protein sequence (420 aa)
HaloTag ORF Clone	FHC00799
Flexi ORF Clone	FXC00799
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA1293 by Kazusa Mouse cDNA Project

Length: 1430 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	56 bp
Genome contig ID	gi89161185f_153445379
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGAGGAGGCTCTCAATAAATAATCGTGTAACCTT
Flanking genome sequence (111703 - 111752)	----+--------+--------+--------+--------+----* CTTGTGGTTCTGTTCTTGCTCGGCCCAGCCAGAGTCTGGCTCTTTCCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	153545379	153557080	11	100.0	Perfect prediction

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P14324	4.3e-189	100.0	Farnesyl pyroph...	Homo sapiens
CAH91070	1.1e-185	98.1	hypothetical pr...	Pongo abelii
XP_001116071	1.1e-184	97.4	farnesyl diphos...	Macaca mulatta
XP_001929119	1.5e-168	87.4	similar to FDPS...	Sus scrofa
XP_537252	1e-166	87.1	similar to farn...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000092	111	383	PF00348	Polyprenyl synthetase
ScanRegExp	IPR000092	167	181	PS00723	Polyprenyl synthetase
ScanRegExp	IPR000092	302	314	PS00444	Polyprenyl synthetase

Primer_f
Primer_r
PCR conditions	test