KIAA0014

Product ID	ORK00363
Accession No	D25216
Description	leucine rich repeat containing 14, transcript variant 2
Clone name	ha00442
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5323 bp) Predicted protein sequence (513 aa)
HaloTag ORF Clone	FHC00363
Flexi ORF Clone	FXC00363
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0014 by Kazusa Mouse cDNA Project

Length: 5323 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3695 bp
Genome contig ID	gi51511724f_145615806
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GAAACTAATAAAACGTTCTGGTTTTCTCCTTTGAC
Flanking genome sequence (105561 - 105610)	----+--------+--------+--------+--------+----* AAAAACATTTTCTTAAAGCTCTGGGGCATCAGGTTCAAATTTAGAATTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	145714199	145721365	4	99.1	Perfect prediction

Length: 513 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15048	1.3e-209	100.0	Leucine-rich re...	Homo sapiens
BAF82162	3.3e-209	99.8	unnamed protein...	Homo sapiens
XP_001094307	5.2e-207	98.8	leucine rich re...	Macaca mulatta
XP_539223	1.2e-203	95.4	similar to Leuc...	Canis lupus fam...
XP_001926063	3.8e-201	96.1	similar to MGC1...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	358	371	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	412	425	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	357	379	PF00560	Leucine-rich repeat
ScanRegExp	IPR000209	140	150	PS00136	Peptidase S8 and S53

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CAGCAGCAGCGGCAGCAGTT
Primer_r	CATCTATTGGCTGGCTCTCG
PCR product length	152 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles