KIAA1596

Gene/Protein Characteristic Table for KIAA1596

Order Kazusa clone(s) from :

Product ID	ORK04983
Accession No	AB046816
Description	Fanconi anemia, complementation group M
Clone name	fj09605
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4696 bp) Predicted protein sequence (1151 aa)
Source	Human fetal brain
Rouge ID	mKIAA1596 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4696 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	876 bp
Genome contig ID	gi51511730f_44614086
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAGGACTGTGAGTCAATTAAACATCTTTTCCTTAT
Flanking genome sequence (125753 - 125802)	----+--------+--------+--------+--------+----* AAATTACCCAGTCGGGTTATTTCTTCATAGCAGCGTGAGAATGGACTAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	44714086	44739837	11	99.8	Internal No-hit

Features of the protein sequence

Description

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65783	99.8	Fanconi anemia,...	Homo sapiens
AAI40777	99.8	FANCM protein [...	Homo sapiens
Q8IYD8	99.8	Fanconi anemia ...	Homo sapiens
XP_509928	98.9	Fanconi anemia,...	Pan troglodytes
XP_001096470	93.0	similar to Fanc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006166	922	1005	PF02732	DNA repair nuclease

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ATGAAGTCCAGTCTACCACAC
Primer_r	AAGAGAAGTATGTGTCCCAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	CCR
Primer_f	AATCGCATGGTGGTGGAAAGG
Primer_r	CTGTCATAGCTCTTTGTTCTC
PCR product length	185 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp