KIAA1943

Product ID	ORK05348
Accession No	AB075823
Description	adhesion G protein-coupled receptor V1
Clone name	fh10956
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5047 bp) Predicted protein sequence (1054 aa)
Source	Human fetal brain

Length: 5047 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1880 bp
Genome contig ID	gi51511721f_89860132
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATAGAAATCATTTACAATAAAAATCATTTACAATC
Flanking genome sequence (127298 - 127347)	----+--------+--------+--------+--------+----* ATTATAAGAATCATTTACAGTCATTCAGAGATAGCCACTATAAACATTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	89960131	89987428	13	99.4	Perfect prediction

Length: 1054 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW95990	99.9	monogenic, audi...	Homo sapiens
EAW95994	99.8	monogenic, audi...	Homo sapiens
EAW95986	99.8	monogenic, audi...	Homo sapiens
EAW95991	99.8	monogenic, audi...	Homo sapiens
NP_115495	99.8	G protein-coupl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040933	1.6e-06	21.7	KIAA1500

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003644	581	681	PF03160	Na-Ca exchanger/integrin-beta4
HMMSmart	IPR003644	351	449	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	464	567	SM00237	Na-Ca exchanger/integrin-beta4
	IPR003644	581	681	SM00237	Na-Ca exchanger/integrin-beta4

Primer_f	AGCTAGCAGAAACCAACCTCC
Primer_r	TATTTCCCAGCCCAGTTGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-