Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06735 |
---|---|
Accession No | AB067492 |
Description | scinderin |
Clone name | ag00008 |
Vector information | |
cDNA sequence | DNA sequence (2570 bp) Predicted protein sequence (626 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1905
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 12576728 | 12659254 | 15 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR007122 | 372 | 393 | PR00597 | Gelsolin |
IPR007122 | 461 | 477 | PR00597 | Gelsolin | |
IPR007122 | 482 | 500 | PR00597 | Gelsolin | |
IPR007122 | 515 | 535 | PR00597 | Gelsolin | |
HMMPfam | IPR007123 | 72 | 154 | PF00626 | Gelsolin region |
IPR007123 | 192 | 267 | PF00626 | Gelsolin region | |
IPR007123 | 309 | 387 | PF00626 | Gelsolin region | |
IPR007123 | 451 | 529 | PF00626 | Gelsolin region | |
HMMSmart | IPR007122 | 63 | 160 | SM00262 | Gelsolin |
IPR007122 | 181 | 273 | SM00262 | Gelsolin | |
IPR007122 | 298 | 393 | SM00262 | Gelsolin | |
IPR007122 | 442 | 535 | SM00262 | Gelsolin |
RT-PCR-ELISA |
Primer_f | CTGGAGGATTGAGAAGCTGGA |
---|---|
Primer_r | AAGTGCAGGTGGTAGGTGAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |