KIAA0525

Product ID	ORK00551
Accession No	AB011097
Description	endoplasmic reticulum aminopeptidase 1, transcript variant 1
Clone name	hg02148s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-329) was subcloned upstream of the cDNA (330-6528). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGCC GCACTAGTGA TT-5' end of cDNA.
cDNA sequence	DNA sequence (6528 bp) Predicted protein sequence (951 aa)
HaloTag ORF Clone	FHC00551
Flexi ORF Clone	FXC00551
Source	Human adult brain
Note	We replaced hg02148, former representative clones for KIAA0525 with hg02148s1. (2002/5/10)

Length: 6528 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3660 bp
Genome contig ID	gi51511721r_96021000
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GGCTACCTTATTAAAACTTTTAGAAATTTCAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTCAATAAGCATTTAGTTTATCAGGTTTCTCTTTTTCTCTTTCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	96121000	96165406	19	99.1	Perfect prediction

Length: 951 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09753	100.0	adipocyte-deriv...	synthetic construct
AAK37777	99.9	adipocyte-deriv...	Homo sapiens
EAW96078	99.7	type 1 tumor ne...	Homo sapiens
NP_057526	99.4	type 1 tumor ne...	Homo sapiens
AAQ88953	100.0	ARTS-1 [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR014782	191	206	PR00756	Peptidase M1
	IPR014782	239	254	PR00756	Peptidase M1
	IPR014782	317	327	PR00756	Peptidase M1
	IPR014782	353	368	PR00756	Peptidase M1
	IPR014782	372	384	PR00756	Peptidase M1
HMMPfam	IPR014782	57	444	PF01433	Peptidase M1
ScanRegExp	IPR006025	353	362	PS00142	Peptidase M

Primer_f	GTTCTAGTGAGTGAGTTATGG
Primer_r	TGAAACCTGACACCGTATACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTCTAGTGAGTGAGTTATGG
Primer_r	TGAAACCTGACACCGTATACC
PCR product length	208 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles