Order Kazusa clone(s) from : ![]() |
Product ID | ORK00551 |
---|---|
Accession No | AB011097 |
Description | endoplasmic reticulum aminopeptidase 1, transcript variant 1 |
Clone name | hg02148s1 |
Vector information | |
cDNA sequence | DNA sequence (6528 bp) Predicted protein sequence (951 aa) |
HaloTag ORF Clone |
FHC00551
![]() |
Flexi ORF Clone | FXC00551 |
Source | Human adult brain |
Note | We replaced hg02148, former representative clones for KIAA0525 with hg02148s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3660 bp |
---|---|
Genome contig ID | gi51511721r_96021000 |
PolyA signal sequence (ATTAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 96121000 | 96165406 | 19 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR014782 | 191 | 206 | PR00756 | Peptidase M1 |
IPR014782 | 239 | 254 | PR00756 | Peptidase M1 | |
IPR014782 | 317 | 327 | PR00756 | Peptidase M1 | |
IPR014782 | 353 | 368 | PR00756 | Peptidase M1 | |
IPR014782 | 372 | 384 | PR00756 | Peptidase M1 | |
HMMPfam | IPR014782 | 57 | 444 | PF01433 | Peptidase M1 |
ScanRegExp | IPR006025 | 353 | 362 | PS00142 | Peptidase M |
![]() |
---|
Primer_f | GTTCTAGTGAGTGAGTTATGG |
---|---|
Primer_r | TGAAACCTGACACCGTATACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTCTAGTGAGTGAGTTATGG |
Primer_r | TGAAACCTGACACCGTATACC |
PCR product length | 208 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |