| ROUGE |
Gene/Protein Characteristic Table for mKIAA4257 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220162 |
|---|---|
| mpf00484 [Vector Info] | |
| Source : | Mouse embryonic tail |
| Note : | The gene name of mpf00484 was changed from mKIAA1438 to mKIAA4257, because this gene is not a mouse ortholog of KIAA1438 |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5964 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3066 bp Genome contig ID gi65492966r_107022965 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATCTTCTATTGAAGAGGGCCTTAATGACTTAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAATAGAGACAATTTCTGAACTTTTTTCCCCTCTTGTCTTTGT
Features of the protein sequence |
Description | |
Coding region: 19..2895
Length: 959 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |