ROUGE

Gene/Protein Characteristic Table for mKIAA4257

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220162
Description :
Clone Name :	mpf00484 [Vector Info]
Source :	Mouse embryonic tail
Note :	The gene name of mpf00484 was changed from mKIAA1438 to mKIAA4257, because this gene is not a mouse ortholog of KIAA1438

Features of the cloned DNA sequence	Description

Length: 5964 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3066 bp

Genome contig ID gi65492966r_107022965
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATCTTCTATTGAAGAGGGCCTTAATGACTTAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAATAGAGACAATTTCTGAACTTTTTTCCCCTCTTGTCTTTGT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 19..2895
Length: 959 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI20591	99.9	RNA binding mot...	Mus musculus
EDL81875	99.0	rCG28930, isofo...	Rattus norvegicus
BAE38672	99.8	unnamed protein...	Mus musculus
AAH57038	99.9	Rbm15 protein [...	Mus musculus
AAH51409	99.9	Rbm15 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 172 247 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 376 446 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 457 524 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

IPR012921 790 926 PF07744 SPOC

HMMSmart IPR000504 171 248 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 375 447 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 456 525 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

ProfileScan NULL 61 166 PS50315 NULL

NULL 65 159 PS50324 NULL

IPR000504 170 252 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 374 451 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 455 529 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

NULL 616 734 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	172	247	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	376	446	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	457	524	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
IPR012921	790	926	PF07744	SPOC
HMMSmart	IPR000504	171	248	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	375	447	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	456	525	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	NULL	61	166	PS50315	NULL
NULL	65	159	PS50324	NULL
IPR000504	170	252	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	374	451	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	455	529	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
NULL	616	734	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3066 bp
Genome contig ID	gi65492966r_107022965
PolyA signal sequence (None)	+--------+--------+----*----+---- ATCTTCTATTGAAGAGGGCCTTAATGACTTAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAATAGAGACAATTTCTGAACTTTTTTCCCCTCTTGTCTTTGT

Gene/Protein Characteristic Table for mKIAA4257

Features of the cloned DNA sequence

Features of the protein sequence