ROUGE |
Gene/Protein Characteristic Table for mKIAA4119 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220495 |
---|---|
tetratricopeptide repeat domain 3. | |
mfj57129 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3710 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi65546577f_93665024 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GCATTGCATTGAAAAAAGTTGCCTCAAGACTCAAGFlanking genome sequence
(175076 - 175125) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAGAAGAAAAACATGAAAGCTAAAGTTGAAGACATTTCAAA
Features of the protein sequence |
Description | |
Coding region: 60..3707
Length: 1217 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |