ROUGE

Gene/Protein Characteristic Table for mKIAA4069

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220176
Description :	Protein kinase ATR (Fragment).
Clone Name :	mej01380 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2886 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 26 bp

Genome contig ID gi65519420f_95718517
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
TATATGTAAAATAAAATTATTTCAAAGAATAAAAC
Flanking genome sequence
(136678 - 136727)
----+----*----+----*----+----*----+----*----+----*
TTAGTAATCTGAAATCCATGTTACTAATCAGTGGTTTGCCTTTAATTCTA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..2857
Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_063917	100.0	ataxia telangie...	Mus musculus
BAE21043	99.9	unnamed protein...	Mus musculus
Q9JKK8	99.9	Serine/threonin...	Mus musculus
EDL77509	98.8	rCG25251 [Rattu...	Rattus norvegicus
XP_001068985	98.8	similar to Seri...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000403 629 875 PF00454 Phosphatidylinositol 3- and 4-kinase

IPR003152 920 952 PF02260 PIK-related kinase

HMMSmart IPR000403 631 941 SM00146 Phosphatidylinositol 3- and 4-kinase

ProfileScan IPR000403 630 952 PS50290 Phosphatidylinositol 3- and 4-kinase

ScanRegExp IPR000403 768 788 PS00916 Phosphatidylinositol 3- and 4-kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000403	629	875	PF00454	Phosphatidylinositol 3- and 4-kinase
IPR003152	920	952	PF02260	PIK-related kinase
HMMSmart	IPR000403	631	941	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR000403	630	952	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	768	788	PS00916	Phosphatidylinositol 3- and 4-kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	26 bp
Genome contig ID	gi65519420f_95718517
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- TATATGTAAAATAAAATTATTTCAAAGAATAAAAC
Flanking genome sequence (136678 - 136727)	----+--------+--------+--------+--------+----* TTAGTAATCTGAAATCCATGTTACTAATCAGTGGTTTGCCTTTAATTCTA

Gene/Protein Characteristic Table for mKIAA4069

Features of the cloned DNA sequence

Features of the protein sequence