ROUGE

Gene/Protein Characteristic Table for mKIAA4047

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220173
Description :	CCAAT displacement protein (Fragment).
Clone Name :	mpm11085 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5229 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 708 bp

Genome contig ID gi65498774r_135187575
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
AAAATAAAACACATTTACTCCACATATTTTTTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAAAAAGAAAAGTCACATCAGGAAAAGTATCTGATTTTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..4518
Length: 1506 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P53564	98.4	Homeobox protei...	Mus musculus
AAK59986	98.3	CCAAT displacem...	Mus musculus
NP_034116	91.7	cut-like homeob...	Mus musculus
AAH90847	91.6	Cut-like homeob...	Mus musculus
EDL19309	98.5	cut-like 1 (Dro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001356 1231 1287 PD000010 Homeobox

HMMPfam IPR003350 553 640 PF02376 Homeodomain protein CUT

IPR003350 920 1007 PF02376 Homeodomain protein CUT

IPR003350 1103 1190 PF02376 Homeodomain protein CUT

IPR001356 1231 1287 PF00046 Homeobox

HMMSmart IPR001356 1230 1292 SM00389 Homeobox

ProfileScan IPR001356 1228 1288 PS50071 Homeobox

IPR007108 1229 1289 PS50560 Cut homeobox

NULL 1349 1454 PS50310 NULL

ScanRegExp IPR001356 1263 1286 PS00027 Homeobox

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	1231	1287	PD000010	Homeobox
HMMPfam	IPR003350	553	640	PF02376	Homeodomain protein CUT
IPR003350	920	1007	PF02376	Homeodomain protein CUT
IPR003350	1103	1190	PF02376	Homeodomain protein CUT
IPR001356	1231	1287	PF00046	Homeobox
HMMSmart	IPR001356	1230	1292	SM00389	Homeobox
ProfileScan	IPR001356	1228	1288	PS50071	Homeobox
IPR007108	1229	1289	PS50560	Cut homeobox
NULL	1349	1454	PS50310	NULL
ScanRegExp	IPR001356	1263	1286	PS00027	Homeobox

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	708 bp
Genome contig ID	gi65498774r_135187575
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAACACATTTACTCCACATATTTTTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAAAAAGAAAAGTCACATCAGGAAAAGTATCTGATTTTG

Gene/Protein Characteristic Table for mKIAA4047

Features of the cloned DNA sequence

Features of the protein sequence