ROUGE |
Gene/Protein Characteristic Table for mKIAA4047 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220173 |
---|---|
CCAAT displacement protein (Fragment). | |
mpm11085 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5229 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 708 bp Genome contig ID gi65498774r_135187575 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
AAAATAAAACACATTTACTCCACATATTTTTTAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAAAAAGAAAAGTCACATCAGGAAAAGTATCTGATTTTG
Features of the protein sequence |
Description | |
Coding region: 1..4518
Length: 1506 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |