| ROUGE |
Gene/Protein Characteristic Table for mKIAA4047 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220173 |
|---|---|
| CCAAT displacement protein (Fragment). | |
| mpm11085 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5229 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 708 bp Genome contig ID gi65498774r_135187575 PolyA signal sequence
(AATAAA,-33)
AAAATAAAACACATTTACTCCACATATTTTTTAACFlanking genome sequence
(100000 - 99951)
AAAAAAAGAAAAAAAAAGAAAAGTCACATCAGGAAAAGTATCTGATTTTG
Features of the protein sequence |
Description | |
Coding region: 1..4518
Length: 1506 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001356 | 1231 | 1287 | PD000010 | Homeobox |
| HMMPfam | IPR003350 | 553 | 640 | PF02376 | Homeodomain protein CUT |
| IPR003350 | 920 | 1007 | PF02376 | Homeodomain protein CUT | |
| IPR003350 | 1103 | 1190 | PF02376 | Homeodomain protein CUT | |
| IPR001356 | 1231 | 1287 | PF00046 | Homeobox | |
| HMMSmart | IPR001356 | 1230 | 1292 | SM00389 | Homeobox |
| ProfileScan | IPR001356 | 1228 | 1288 | PS50071 | Homeobox |
| IPR007108 | 1229 | 1289 | PS50560 | Cut homeobox | |
| NULL | 1349 | 1454 | PS50310 | NULL | |
| ScanRegExp | IPR001356 | 1263 | 1286 | PS00027 | Homeobox |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
