ROUGE

Gene/Protein Characteristic Table for mKIAA4031

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220450
Description :	Mitogen-activated protein kinase kinase kinase 3.
Clone Name :	mbh03479 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4037 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2635 bp

Genome contig ID gi65527427f_105805698
PolyA signal sequence
(ATTAAA,-13)
+----*----+----*----+----*----+----
TCCCAAATTTTTGGGAGTTATCATTAAAGGAAAGG
Flanking genome sequence
(170826 - 170875)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAGCCAGTGCCCAGGGATGGGCATCTCCAGGGAGC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 278..1399
Length: 374 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL34263	1.5e-137	98.9	mitogen activat...	Mus musculus
BAE23244	5.4e-132	98.9	unnamed protein...	Mus musculus
Q61084	5.4e-132	98.9	Mitogen-activat...	Mus musculus
EDM06356	1.9e-130	97.2	mitogen activat...	Rattus norvegicus
XP_537600	1.2e-125	94.2	similar to mito...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000270 59 138 PF00564 Octicosapeptide/Phox/Bem1p

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000270	59	138	PF00564	Octicosapeptide/Phox/Bem1p

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2635 bp
Genome contig ID	gi65527427f_105805698
PolyA signal sequence (ATTAAA,-13)	+--------+--------+----*----+---- TCCCAAATTTTTGGGAGTTATCATTAAAGGAAAGG
Flanking genome sequence (170826 - 170875)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAGCCAGTGCCCAGGGATGGGCATCTCCAGGGAGC

Gene/Protein Characteristic Table for mKIAA4031

Features of the cloned DNA sequence

Features of the protein sequence