ROUGE

Gene/Protein Characteristic Table for mKIAA2026

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220440
Description :
Clone Name :	mbp12134 [Vector Info]
Source :	Mouse brain
Note :	A mutation resulted in loss of the NotI site in the vector (GCGGCCGC -> GCCGC) was found.

Features of the cloned DNA sequence	Description

Length: 1792 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 41 bp

Genome contig ID gi65553144r_28868570
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTGACTGAGCCAGTTTTTAAATAACAGGGCAGCG
Flanking genome sequence
(99997 - 99948)
----+----*----+----*----+----*----+----*----+----*
TTTTAACTCCCATAAAAATTTTAACTGTTTATTATACTGTTGAAAACATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2026 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2026	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1751
Length: 582 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_219779	4.9e-157	87.3	similar to Y40C...	Rattus norvegicus
BAC29616	4.2e-155	100.0	unnamed protein...	Mus musculus
AAI05764	1.4e-139	87.3	RGD1311595 prot...	Rattus norvegicus
EDM13103	3.6e-133	87.0	rCG47386 [Rattu...	Rattus norvegicus
XP_001917272	7.4e-132	76.7	similar to K06A...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	41 bp
Genome contig ID	gi65553144r_28868570
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTGACTGAGCCAGTTTTTAAATAACAGGGCAGCG
Flanking genome sequence (99997 - 99948)	----+--------+--------+--------+--------+----* TTTTAACTCCCATAAAAATTTTAACTGTTTATTATACTGTTGAAAACATA

Gene/Protein Characteristic Table for mKIAA2026

Features of the cloned DNA sequence

Features of the protein sequence