ROUGE

Gene/Protein Characteristic Table for mKIAA1971

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220273
Description :	Weakly similar to similar to junction-mediating and regulatory protein.
Clone Name :	mid04002 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 657 bp

Genome contig ID gi65511124f_75279432
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CAATCATGGATCCCTATTAAACTAAATGAACCCAC
Flanking genome sequence
(125546 - 125595)
----+----*----+----*----+----*----+----*----+----*
ATTTCTCGTTTCCAGAGGCCTTCCATTTCTTTTGCATTCCATCTGGCCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1971 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1971	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 16..2412
Length: 798 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q571B6	0	100.0	WASP homolog as...	Mus musculus
AAH42749	9.3e-197	96.7	WAS protein hom...	Mus musculus
EDM08696	6.1e-195	87.1	similar to junc...	Rattus norvegicus
EDL06932	2.3e-193	98.0	WAS protein hom...	Mus musculus
Q8TF30	1.2e-138	66.5	WASP homolog as...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 733 750 PF02205 Actin-binding WH2

ProfileScan IPR000694 596 659 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	733	750	PF02205	Actin-binding WH2
ProfileScan	IPR000694	596	659	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	657 bp
Genome contig ID	gi65511124f_75279432
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAATCATGGATCCCTATTAAACTAAATGAACCCAC
Flanking genome sequence (125546 - 125595)	----+--------+--------+--------+--------+----* ATTTCTCGTTTCCAGAGGCCTTCCATTTCTTTTGCATTCCATCTGGCCAG

Gene/Protein Characteristic Table for mKIAA1971

Features of the cloned DNA sequence

Features of the protein sequence