ROUGE |
Gene/Protein Characteristic Table for mKIAA1935 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173305 |
---|---|
mph00903 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3269 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 989 bp Genome contig ID gi65527427f_43334896 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AAAAAAAAAAGCTGTAAATAAAATCAACTAAATCCFlanking genome sequence
(125135 - 125184) ----+----*----+----*----+----*----+----*----+----*
AAATTATTTGTGTGTGTTTCTCAAAAAGCTTTGAACAGTTTCAAAATAGT
KIAA Alignment based on: KIAA1935 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 64..2280
Length: 738 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000313 | 635 | 711 | PF00855 | PWWP |
HMMSmart | IPR000313 | 636 | 696 | SM00293 | PWWP |
ProfileScan | IPR000694 | 33 | 134 | PS50099 | Proline-rich region |
IPR000694 | 228 | 274 | PS50099 | Proline-rich region | |
NULL | 541 | 615 | PS50324 | NULL | |
IPR000313 | 638 | 698 | PS50812 | PWWP |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |