ROUGE

Gene/Protein Characteristic Table for mKIAA1931

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173303
Description :
Clone Name :	mbh04017 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3189 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 397 bp

Genome contig ID gi65535943r_54055876
PolyA signal sequence
(GATAAA,-23)
+----*----+----*----+----*----+----
TTCATGGGGAGAGATAAAGCAACATTTGGACACAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTAGTATGATGGTGATTTGCTGATCTGAATGGGGAGTGGGAGAGAGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1931 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1931	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 288..2792
Length: 834 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE33140	0	100.0	unnamed protein...	Mus musculus
XP_573985	8.8e-212	94.5	hypothetical pr...	Rattus norvegicus
XP_001095406	1.9e-202	85.7	hypothetical pr...	Macaca mulatta
EDL41212	6.4e-191	90.4	cDNA sequence B...	Mus musculus
NP_061930	6.1e-190	86.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 96 166 PS50324 NULL

IPR000694 189 297 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	96	166	PS50324	NULL
IPR000694	189	297	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	397 bp
Genome contig ID	gi65535943r_54055876
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- TTCATGGGGAGAGATAAAGCAACATTTGGACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTAGTATGATGGTGATTTGCTGATCTGAATGGGGAGTGGGAGAGAGGT

Gene/Protein Characteristic Table for mKIAA1931

Features of the cloned DNA sequence

Features of the protein sequence