ROUGE

Gene/Protein Characteristic Table for mKIAA1877

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129462
Description :	beta-galactoside alpha-2,6-sialyltransferase II.
Clone Name :	mpm03373 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4842 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4180 bp

Genome contig ID gi65550231f_53028774
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ACAGACTTGTAAATAAAACATGTTTTCATTTATCT
Flanking genome sequence
(123654 - 123703)
----+----*----+----*----+----*----+----*----+----*
AGAAGTGTCTCTGCTTTAATCTGGAAACACTGAACATGTAAATAAATGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1877 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1877	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..662
Length: 219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q76K27	1.1e-102	99.5	Beta-galactosid...	Mus musculus
CAP19181	1.1e-102	99.5	beta galactosid...	Mus musculus
Q701R3	6e-100	96.3	Beta-galactosid...	Rattus norvegicus
XP_001109602	4.8e-95	91.7	similar to beta...	Macaca mulatta
Q701R4	1.3e-94	90.7	Beta-galactosid...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001675 1 196 PF00777 Glycosyl transferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001675	1	196	PF00777	Glycosyl transferase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4180 bp
Genome contig ID	gi65550231f_53028774
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACAGACTTGTAAATAAAACATGTTTTCATTTATCT
Flanking genome sequence (123654 - 123703)	----+--------+--------+--------+--------+----* AGAAGTGTCTCTGCTTTAATCTGGAAACACTGAACATGTAAATAAATGTG

Gene/Protein Characteristic Table for mKIAA1877

Features of the cloned DNA sequence

Features of the protein sequence