ROUGE

Gene/Protein Characteristic Table for mKIAA1873

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129460
Description :
Clone Name :	mph02296 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2949 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 337 bp

Genome contig ID gi65504368r_149678377
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATGCCTCGTTGTGCCTCAATAAAAATTTAAACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTCCAGTTGTTTCTGTTTGCATAAACATTTGATTGAGAGTTAAGAATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1873 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1873	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 33..2612
Length: 859 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAQ52304	5.1e-193	99.8	caprin family m...	Mus musculus
CAQ52303	3.4e-173	99.1	caprin family m...	Mus musculus
Q05A80	4e-173	78.7	Caprin-2; Cytop...	Mus musculus
EAW96616	8.6e-146	63.9	C1q domain cont...	Homo sapiens
NP_115532	3e-145	82.9	C1q domain cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001073 742 768 PR00007 Complement C1q protein

IPR001073 769 788 PR00007 Complement C1q protein

IPR001073 816 837 PR00007 Complement C1q protein

IPR001073 847 857 PR00007 Complement C1q protein

HMMPfam IPR001073 731 856 PF00386 Complement C1q protein

HMMSmart IPR001073 723 859 SM00110 Complement C1q protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001073	742	768	PR00007	Complement C1q protein
IPR001073	769	788	PR00007	Complement C1q protein
IPR001073	816	837	PR00007	Complement C1q protein
IPR001073	847	857	PR00007	Complement C1q protein
HMMPfam	IPR001073	731	856	PF00386	Complement C1q protein
HMMSmart	IPR001073	723	859	SM00110	Complement C1q protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	337 bp
Genome contig ID	gi65504368r_149678377
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGCCTCGTTGTGCCTCAATAAAAATTTAAACTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCCAGTTGTTTCTGTTTGCATAAACATTTGATTGAGAGTTAAGAATT

Gene/Protein Characteristic Table for mKIAA1873

Features of the cloned DNA sequence

Features of the protein sequence