ROUGE |
Gene/Protein Characteristic Table for mKIAA1862 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173281 |
---|---|
mbg03386 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5753 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 509 bp Genome contig ID gi65504368f_48428537 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CCACATAGATTCTAAAATTAAATGTATTAGTTGCTFlanking genome sequence
(121243 - 121292) ----+----*----+----*----+----*----+----*----+----*
AAGTAAAGGCCATTGGCTTCTGTGGAAGGGTGCTCAGAGGGGACAACACT
KIAA Alignment based on: KIAA1862 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1948..5244
Length: 1098 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001909 | 27 | 67 | PF01352 | KRAB box |
HMMSmart | IPR001909 | 27 | 89 | SM00349 | KRAB box |
ProfileScan | IPR001909 | 27 | 99 | PS50805 | KRAB box |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |