ROUGE

Gene/Protein Characteristic Table for mKIAA1862

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173281
Description :
Clone Name :	mbg03386 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5753 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 509 bp

Genome contig ID gi65504368f_48428537
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CCACATAGATTCTAAAATTAAATGTATTAGTTGCT
Flanking genome sequence
(121243 - 121292)
----+----*----+----*----+----*----+----*----+----*
AAGTAAAGGCCATTGGCTTCTGTGGAAGGGTGCTCAGAGGGGACAACACT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1862 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1862	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1948..5244
Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDK98524	99.7	RIKEN cDNA A930...	Mus musculus
EDK98523	99.6	RIKEN cDNA A930...	Mus musculus
Q6NXZ1	99.9	Protein KRBA1.	Mus musculus
EDK98525	93.6	RIKEN cDNA A930...	Mus musculus
BAA95028	93.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001909 27 67 PF01352 KRAB box

HMMSmart IPR001909 27 89 SM00349 KRAB box

ProfileScan IPR001909 27 99 PS50805 KRAB box

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	27	67	PF01352	KRAB box
HMMSmart	IPR001909	27	89	SM00349	KRAB box
ProfileScan	IPR001909	27	99	PS50805	KRAB box

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	509 bp
Genome contig ID	gi65504368f_48428537
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CCACATAGATTCTAAAATTAAATGTATTAGTTGCT
Flanking genome sequence (121243 - 121292)	----+--------+--------+--------+--------+----* AAGTAAAGGCCATTGGCTTCTGTGGAAGGGTGCTCAGAGGGGACAACACT

Gene/Protein Characteristic Table for mKIAA1862

Features of the cloned DNA sequence

Features of the protein sequence