ROUGE

Gene/Protein Characteristic Table for mKIAA1847

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173276
Description :	Lck-interacting transmembrane adaptor protein.
Clone Name :	mfj06075 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4892 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3199 bp

Genome contig ID gi66880554f_180982410
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CCAGTCCTTGAGGCCTAATTAAACCTCTGTTCAAT
Flanking genome sequence
(118176 - 118225)
----+----*----+----*----+----*----+----*----+----*
AAGGTTGGCTCTTGGTTGCTTTTTATCTATATCTATCTATCTATTTTGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1847 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1847	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 125..1690
Length: 522 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL07411	7.5e-199	99.8	zinc finger, CC...	Mus musculus
Q8VDM1	5.8e-184	99.8	Zinc finger CCC...	Mus musculus
BAE35381	1.4e-183	99.6	unnamed protein...	Mus musculus
BAC33909	1.4e-183	99.6	unnamed protein...	Mus musculus
AAH87720	2.3e-172	94.6	Zinc finger, CC...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 206 231 PF00642 Zinc finger

IPR000467 345 389 PF01585 D111/G-patch

HMMSmart IPR000571 206 231 SM00356 Zinc finger

IPR000467 343 389 SM00443 D111/G-patch

ProfileScan IPR000467 345 391 PS50174 D111/G-patch

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 7 29 CPELFLLLFLLFLSAVKVPNPAC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	206	231	PF00642	Zinc finger
IPR000467	345	389	PF01585	D111/G-patch
HMMSmart	IPR000571	206	231	SM00356	Zinc finger
IPR000467	343	389	SM00443	D111/G-patch
ProfileScan	IPR000467	345	391	PS50174	D111/G-patch

Method	From	To	amino acid sequence
SOSUI	7	29	CPELFLLLFLLFLSAVKVPNPAC

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3199 bp
Genome contig ID	gi66880554f_180982410
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CCAGTCCTTGAGGCCTAATTAAACCTCTGTTCAAT
Flanking genome sequence (118176 - 118225)	----+--------+--------+--------+--------+----* AAGGTTGGCTCTTGGTTGCTTTTTATCTATATCTATCTATCTATTTTGAA

Gene/Protein Characteristic Table for mKIAA1847

Features of the cloned DNA sequence

Features of the protein sequence