| ROUGE |
Gene/Protein Characteristic Table for mKIAA1847 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173276 |
|---|---|
| Lck-interacting transmembrane adaptor protein. | |
| mfj06075 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4892 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3199 bp Genome contig ID gi66880554f_180982410 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
CCAGTCCTTGAGGCCTAATTAAACCTCTGTTCAATFlanking genome sequence
(118176 - 118225) ----+----*----+----*----+----*----+----*----+----*
AAGGTTGGCTCTTGGTTGCTTTTTATCTATATCTATCTATCTATTTTGAA
KIAA Alignment based on: KIAA1847 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 125..1690
Length: 522 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |