ROUGE |
Gene/Protein Characteristic Table for mKIAA1843 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173273 |
---|---|
mbg11903 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5491 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1051 bp Genome contig ID gi65488608f_66819261 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACAAATAGGGCTTTAACTTAAAGTGCAGTTACTTCFlanking genome sequence
(169771 - 169820) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAATAAAATTTGAAAGGCTTGTCAGGCCAGTACTTAGTC
KIAA Alignment based on: KIAA1843 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..4440
Length: 1479 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |