ROUGE

Gene/Protein Characteristic Table for mKIAA1790

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129441
Description :
Clone Name :	mpf00986 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6864 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1166 bp

Genome contig ID gi65511124r_60042974
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GACTGGTGTCATCTGAGAATAAACAGACTTAGACG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACATGGCCTTTGTCTCTTGAGTGCGACACACAGGCTCTGGCCTTCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1790 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1790	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..5698
Length: 1898 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3UHC2	99.7	Leucine-rich re...	Mus musculus
XP_218760	96.2	similar to leuc...	Rattus norvegicus
XP_001489911	90.7	leucine-rich re...	Equus caballus
AAY67799	90.7	leucine-rich re...	Homo sapiens
NP_078928	90.7	leucine-rich re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220424	1e-08	31.3	mKIAA1804
BC049775	2.6e-07	30.2	mKIAA0862
AK220543	9.6e-07	27.5	mKIAA4203
AK173323	1.7e-06	30.0	mKIAA1995
AK122498	1.7e-06	29.1	mKIAA1365

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 1181 1395 PD000001 Protein kinase

FPrintScan IPR001611 266 279 PR00019 Leucine-rich repeat

IPR001611 380 393 PR00019 Leucine-rich repeat

HMMPfam IPR001611 163 186 PF00560 Leucine-rich repeat

IPR001611 187 208 PF00560 Leucine-rich repeat

IPR001611 214 236 PF00560 Leucine-rich repeat

IPR001611 265 288 PF00560 Leucine-rich repeat

IPR001611 289 312 PF00560 Leucine-rich repeat

IPR001611 382 401 PF00560 Leucine-rich repeat

IPR001611 433 455 PF00560 Leucine-rich repeat

IPR001611 456 479 PF00560 Leucine-rich repeat

NULL 1117 1404 PF07714 NULL

IPR000719 1126 1404 PF00069 Protein kinase

HMMSmart IPR002110 3 32 SM00248 Ankyrin

IPR002110 36 66 SM00248 Ankyrin

IPR002110 77 107 SM00248 Ankyrin

IPR003591 162 184 SM00369 Leucine-rich repeat

NULL 185 207 SM00366 NULL

IPR003591 185 209 SM00369 Leucine-rich repeat

NULL 212 234 SM00366 NULL

IPR003591 212 235 SM00369 Leucine-rich repeat

NULL 263 285 SM00366 NULL

IPR003591 263 285 SM00369 Leucine-rich repeat

NULL 287 309 SM00366 NULL

IPR003591 287 311 SM00369 Leucine-rich repeat

NULL 356 379 SM00366 NULL

IPR003591 356 377 SM00369 Leucine-rich repeat

NULL 380 402 SM00366 NULL

IPR003591 432 453 SM00369 Leucine-rich repeat

NULL 454 477 SM00366 NULL

IPR003591 454 478 SM00369 Leucine-rich repeat

NULL 478 500 SM00366 NULL

IPR002290 1126 1409 SM00220 Serine/threonine protein kinase

IPR001245 1126 1404 SM00219 Tyrosine protein kinase

ProfileScan IPR002110 3 102 PS50297 Ankyrin

IPR000719 1126 1409 PS50011 Protein kinase

NULL 1723 1755 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1181	1395	PD000001	Protein kinase
FPrintScan	IPR001611	266	279	PR00019	Leucine-rich repeat
IPR001611	380	393	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	163	186	PF00560	Leucine-rich repeat
IPR001611	187	208	PF00560	Leucine-rich repeat
IPR001611	214	236	PF00560	Leucine-rich repeat
IPR001611	265	288	PF00560	Leucine-rich repeat
IPR001611	289	312	PF00560	Leucine-rich repeat
IPR001611	382	401	PF00560	Leucine-rich repeat
IPR001611	433	455	PF00560	Leucine-rich repeat
IPR001611	456	479	PF00560	Leucine-rich repeat
NULL	1117	1404	PF07714	NULL
IPR000719	1126	1404	PF00069	Protein kinase
HMMSmart	IPR002110	3	32	SM00248	Ankyrin
IPR002110	36	66	SM00248	Ankyrin
IPR002110	77	107	SM00248	Ankyrin
IPR003591	162	184	SM00369	Leucine-rich repeat
NULL	185	207	SM00366	NULL
IPR003591	185	209	SM00369	Leucine-rich repeat
NULL	212	234	SM00366	NULL
IPR003591	212	235	SM00369	Leucine-rich repeat
NULL	263	285	SM00366	NULL
IPR003591	263	285	SM00369	Leucine-rich repeat
NULL	287	309	SM00366	NULL
IPR003591	287	311	SM00369	Leucine-rich repeat
NULL	356	379	SM00366	NULL
IPR003591	356	377	SM00369	Leucine-rich repeat
NULL	380	402	SM00366	NULL
IPR003591	432	453	SM00369	Leucine-rich repeat
NULL	454	477	SM00366	NULL
IPR003591	454	478	SM00369	Leucine-rich repeat
NULL	478	500	SM00366	NULL
IPR002290	1126	1409	SM00220	Serine/threonine protein kinase
IPR001245	1126	1404	SM00219	Tyrosine protein kinase
ProfileScan	IPR002110	3	102	PS50297	Ankyrin
IPR000719	1126	1409	PS50011	Protein kinase
NULL	1723	1755	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1166 bp
Genome contig ID	gi65511124r_60042974
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GACTGGTGTCATCTGAGAATAAACAGACTTAGACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACATGGCCTTTGTCTCTTGAGTGCGACACACAGGCTCTGGCCTTCCC

Gene/Protein Characteristic Table for mKIAA1790

Features of the cloned DNA sequence

Features of the protein sequence