ROUGE

Gene/Protein Characteristic Table for mKIAA1663

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122537
Description :	Tob2 protein.
Clone Name :	mbg02432 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5198 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2458 bp

Genome contig ID gi65543215r_81798988
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTTAAGTTTGTATTAAAAGCATGATATATAATAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCTGCCTACTTGTTTGTGTTTCTGGGGTCCCTTTGAGATGGCCCCTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1663 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1663	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1694..2740
Length: 348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL04555	1.8e-119	100.0	mCG8800 [Mus mu...	Mus musculus
Q9JM55	9.5e-119	99.4	Protein Tob2; T...	Mus musculus
AAH85117	2.4e-111	93.1	Transducer of E...	Rattus norvegicus
CAH89879	1.1e-106	89.6	hypothetical pr...	Pongo abelii
AAI23447	3.2e-106	88.4	TOB2 protein [B...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002087 4 118 PF07742 Anti-proliferative protein

HMMSmart IPR002087 4 109 SM00099 Anti-proliferative protein

ScanRegExp IPR002087 43 63 PS00960 Anti-proliferative protein

IPR002087 89 108 PS01203 Anti-proliferative protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002087	4	118	PF07742	Anti-proliferative protein
HMMSmart	IPR002087	4	109	SM00099	Anti-proliferative protein
ScanRegExp	IPR002087	43	63	PS00960	Anti-proliferative protein
IPR002087	89	108	PS01203	Anti-proliferative protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2458 bp
Genome contig ID	gi65543215r_81798988
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTTAAGTTTGTATTAAAAGCATGATATATAATAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGCCTACTTGTTTGTGTTTCTGGGGTCCCTTTGAGATGGCCCCTTC

Gene/Protein Characteristic Table for mKIAA1663

Features of the cloned DNA sequence

Features of the protein sequence