ROUGE

Gene/Protein Characteristic Table for mKIAA1622

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173221
Description :
Clone Name :	mid33080 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3642 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1931 bp

Genome contig ID gi65532617f_98920229
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATGAGCGTATTTAAAATAAAGCAGAGGTTAATGAG
Flanking genome sequence
(137546 - 137595)
----+----*----+----*----+----*----+----*----+----*
ATACCTGTATTTGTGAGAAAAATTTTAAATACTTTCCTACAGTTCTTACT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1622 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1622	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 20..1657, 1910..2644
Length: 790 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL18824	99.2	RIKEN cDNA 8430...	Mus musculus
Q8C0Y0	99.1	Serine/threonin...	Mus musculus
AAI11888	99.1	Protein phospha...	Mus musculus
XP_522937	89.7	HEAT-like repea...	Pan troglodytes
XP_001926088	88.5	similar to HEAT...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 127 163 PF02985 HEAT

IPR000357 166 202 PF02985 HEAT

IPR000357 312 347 PF02985 HEAT

IPR000357 349 384 PF02985 HEAT

ProfileScan IPR000357 133 170 PS50077 HEAT

IPR000357 172 210 PS50077 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	127	163	PF02985	HEAT
IPR000357	166	202	PF02985	HEAT
IPR000357	312	347	PF02985	HEAT
IPR000357	349	384	PF02985	HEAT
ProfileScan	IPR000357	133	170	PS50077	HEAT
IPR000357	172	210	PS50077	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1931 bp
Genome contig ID	gi65532617f_98920229
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGAGCGTATTTAAAATAAAGCAGAGGTTAATGAG
Flanking genome sequence (137546 - 137595)	----+--------+--------+--------+--------+----* ATACCTGTATTTGTGAGAAAAATTTTAAATACTTTCCTACAGTTCTTACT

Gene/Protein Characteristic Table for mKIAA1622

Features of the cloned DNA sequence

Features of the protein sequence