ROUGE |
Gene/Protein Characteristic Table for mKIAA1549 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129390 |
---|---|
mpm09216 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4433 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1977 bp Genome contig ID gi65504368r_38173810 PolyA signal sequence
(AATAAA,-13) +----*----+----*----+----*----+----
TACATAAAATAAAATAAAATAAAATAAATCTTTACFlanking genome sequence
(99692 - 99643) ----+----*----+----*----+----*----+----*----+----*
AAAAGAAAAAAGAAAAAGAAAACAAAAACGCCAAAGTAAATATCTAACAA
KIAA Alignment based on: KIAA1549 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..2456
Length: 817 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |