ROUGE

Gene/Protein Characteristic Table for mKIAA1526

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122523
Description :
Clone Name :	mbh03417 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3178 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 568 bp

Genome contig ID gi65493515r_62406108
PolyA signal sequence
(AATAAA,-13)
+----*----+----*----+----*----+----
TTATGACTTTAATTTTTCAATAAATAAATCTGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGGTTGGGGGCCAGTGTTCTATGCTGTTGTCTGCGGGCTGGGGTTTAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1526 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1526	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2610
Length: 869 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD62268	100.0	whirlin [Mus mu...	Mus musculus
CAD62267	99.9	whirlin [Mus mu...	Mus musculus
AAI50758	99.7	Whirlin [Mus mu...	Mus musculus
AAV87521	99.4	whirlin isoform...	Mus musculus
XP_001096493	88.3	similar to CASK...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 104 183 PF00595 PDZ/DHR/GLGF

IPR001478 243 321 PF00595 PDZ/DHR/GLGF

IPR001478 778 853 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 114 186 SM00228 PDZ/DHR/GLGF

IPR001478 252 324 SM00228 PDZ/DHR/GLGF

IPR001478 786 866 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 104 179 PS50106 PDZ/DHR/GLGF

IPR001478 243 313 PS50106 PDZ/DHR/GLGF

IPR000694 536 675 PS50099 Proline-rich region

IPR001478 778 849 PS50106 PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	104	183	PF00595	PDZ/DHR/GLGF
IPR001478	243	321	PF00595	PDZ/DHR/GLGF
IPR001478	778	853	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	114	186	SM00228	PDZ/DHR/GLGF
IPR001478	252	324	SM00228	PDZ/DHR/GLGF
IPR001478	786	866	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	104	179	PS50106	PDZ/DHR/GLGF
IPR001478	243	313	PS50106	PDZ/DHR/GLGF
IPR000694	536	675	PS50099	Proline-rich region
IPR001478	778	849	PS50106	PDZ/DHR/GLGF

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	568 bp
Genome contig ID	gi65493515r_62406108
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- TTATGACTTTAATTTTTCAATAAATAAATCTGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGTTGGGGGCCAGTGTTCTATGCTGTTGTCTGCGGGCTGGGGTTTAGA

Gene/Protein Characteristic Table for mKIAA1526

Features of the cloned DNA sequence

Features of the protein sequence