ROUGE |
Gene/Protein Characteristic Table for mKIAA1523 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129383 |
---|---|
PHD zinc finger transcription factor. | |
mph00170 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3685 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1927 bp Genome contig ID gi65527427f_77635097 PolyA signal sequence
(TATAAA,-21) +----*----+----*----+----*----+----
TCCTGTATTCTGTATATAAAAACCAAAAATACTTCFlanking genome sequence
(121098 - 121147) ----+----*----+----*----+----*----+----*----+----*
AAATTATGTTTTCTGCCTGTCTGTCCTCCCTGTCATGCTTAGAAGGGGAA
KIAA Alignment based on: KIAA1523 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1728, 1877..2803
Length: 884 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |