ROUGE

Gene/Protein Characteristic Table for mKIAA1521

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129381
Description :
Clone Name :	mpm11207 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5543 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1823 bp

Genome contig ID gi66880554r_34509148
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGGCAGGTTCCTGTGCCTTTATTGCCCTCTTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGTGTCTCTGTAGTTTGGTTTGCGTTGTACATC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1521 DNA sequence

KIAA	Alignment based on:
KIAA1521	DNA sequence

Features of the protein sequence	Description

Coding region: 148..3717, 3721..4491
Length: 1446 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH60123	99.9	GTPase activati...	Mus musculus
XP_001078902	99.1	similar to GTPa...	Rattus norvegicus
XP_231161	99.0	similar to GTPa...	Rattus norvegicus
CAO03611	97.6	GTPase activati...	Homo sapiens
XP_863302	97.4	similar to GTPa...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001936 162 364 PF00616 Ras GTPase-activating protein

IPR003123 1342 1444 PF02204 Vacuolar sorting protein 9

HMMSmart IPR003123 1341 1446 SM00167 Vacuolar sorting protein 9

ProfileScan IPR001936 154 363 PS50018 Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001936	162	364	PF00616	Ras GTPase-activating protein
IPR003123	1342	1444	PF02204	Vacuolar sorting protein 9
HMMSmart	IPR003123	1341	1446	SM00167	Vacuolar sorting protein 9
ProfileScan	IPR001936	154	363	PS50018	Ras GTPase-activating protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1823 bp
Genome contig ID	gi66880554r_34509148
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGGCAGGTTCCTGTGCCTTTATTGCCCTCTTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTGTCTCTGTAGTTTGGTTTGCGTTGTACATC

Gene/Protein Characteristic Table for mKIAA1521

Features of the cloned DNA sequence

Features of the protein sequence