ROUGE

Gene/Protein Characteristic Table for mKIAA1482

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173183
Description :	Similar to similar to stromal interaction molecule 2.
Clone Name :	mia03019 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 957 bp

Genome contig ID gi65498774f_52708661
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTGGAAAAGATAATAAATTGGAGACATTATTGTG
Flanking genome sequence
(221185 - 221234)
----+----*----+----*----+----*----+----*----+----*
TGGGGTTGTGCTGATTTTTGTTGATAACACTCCACTGAAAACACTGTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1482 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1482	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 155..2602
Length: 815 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI37882	100.0	Stim2 protein [...	Mus musculus
AAI45002	99.9	Stim2 protein [...	Mus musculus
NP_001074572	99.0	stromal interac...	Mus musculus
EDL99866	97.0	stromal interac...	Rattus norvegicus
P83093	100.0	Stromal interac...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011510 202 273 PF07647 Sterile alpha motif homology 2

IPR001660 203 271 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 202 273 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 205 263 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	202	273	PF07647	Sterile alpha motif homology 2
IPR001660	203	271	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	202	273	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	205	263	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 282 303 NWMKDFILTISIVIGVGGCWFA

Method	From	To	amino acid sequence
SOSUI	282	303	NWMKDFILTISIVIGVGGCWFA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	957 bp
Genome contig ID	gi65498774f_52708661
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTGGAAAAGATAATAAATTGGAGACATTATTGTG
Flanking genome sequence (221185 - 221234)	----+--------+--------+--------+--------+----* TGGGGTTGTGCTGATTTTTGTTGATAACACTCCACTGAAAACACTGTTTT

Gene/Protein Characteristic Table for mKIAA1482

Features of the cloned DNA sequence

Features of the protein sequence