| ROUGE |
Gene/Protein Characteristic Table for mKIAA1458 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129365 |
|---|---|
| mpm09035 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4315 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2317 bp Genome contig ID gi65498774f_71596105 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TTTGTAAGTGTGTTAATAAAAGTGTAAAGAATTGGFlanking genome sequence
(164848 - 164897) ----+----*----+----*----+----*----+----*----+----*
AAAAATATAAATATTCTTAACTCAAGCATTTGCTGAATCATTTTTCTACA
KIAA Alignment based on: KIAA1458 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 70..1998
Length: 642 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |