ROUGE

Gene/Protein Characteristic Table for mKIAA1456

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220392
Description :
Clone Name :	mbp02158 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1258 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5 bp

Genome contig ID gi65515060f_35210218
PolyA signal sequence
(ATTAAA,-10)
+----*----+----*----+----*----+----
ATTGCAGAGAAAAAAAGGAGCTGGGATTAAACGAC
Flanking genome sequence
(107106 - 107155)
----+----*----+----*----+----*----+----*----+----*
ACGGCTCAAGGCAGAGGCTACGGTGGTGGCCTATCATCTGTTCAACGGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1456 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1456	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1253
Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL35469	3.9e-169	97.6	RIKEN cDNA 6430...	Mus musculus
EDM09213	3.2e-151	88.3	similar to 6430...	Rattus norvegicus
EDM09211	3.8e-125	82.7	similar to 6430...	Rattus norvegicus
EDM09210	1.4e-117	88.5	similar to 6430...	Rattus norvegicus
NP_065895	7.8e-116	71.2	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 13 108 PF08241 NULL

NULL 21 106 PF08242 NULL

ProfileScan IPR000051 21 111 PS50193 SAM (and some other nucleotide) binding motif

IPR001601 71 112 PS50124 Generic methyltransferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	13	108	PF08241	NULL
NULL	21	106	PF08242	NULL
ProfileScan	IPR000051	21	111	PS50193	SAM (and some other nucleotide) binding motif
IPR001601	71	112	PS50124	Generic methyltransferase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5 bp
Genome contig ID	gi65515060f_35210218
PolyA signal sequence (ATTAAA,-10)	+--------+--------+----*----+---- ATTGCAGAGAAAAAAAGGAGCTGGGATTAAACGAC
Flanking genome sequence (107106 - 107155)	----+--------+--------+--------+--------+----* ACGGCTCAAGGCAGAGGCTACGGTGGTGGCCTATCATCTGTTCAACGGGG

Gene/Protein Characteristic Table for mKIAA1456

Features of the cloned DNA sequence

Features of the protein sequence