ROUGE

Gene/Protein Characteristic Table for mKIAA1429

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122509
Description :	Similar to DKFZP434I116 protein.
Clone Name :	mbg00016 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6409 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 985 bp

Genome contig ID gi65493515f_11313021
PolyA signal sequence
(TATAAA,-34)
+----*----+----*----+----*----+----
ATATAAATGGCATAAAATATAGAGTTCTCTTAAAC
Flanking genome sequence
(164631 - 164680)
----+----*----+----*----+----*----+----*----+----*
AAAAATAAGTGTATGAGTCTCATTCCATCCTAACAGCCTCTATTTTGGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1429 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1429	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..5421
Length: 1807 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2AIV2	100.0	Protein viriliz...	Mus musculus
EDL05646	99.9	mCG142037, isof...	Mus musculus
XP_001089437	96.1	similar to viri...	Macaca mulatta
XP_519860	95.7	hypothetical pr...	Pan troglodytes
XP_001489354	95.6	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 135 198 PS50099 Proline-rich region

NULL 188 306 PS50312 NULL

NULL 204 310 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	135	198	PS50099	Proline-rich region
NULL	188	306	PS50312	NULL
NULL	204	310	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	985 bp
Genome contig ID	gi65493515f_11313021
PolyA signal sequence (TATAAA,-34)	+--------+--------+----*----+---- ATATAAATGGCATAAAATATAGAGTTCTCTTAAAC
Flanking genome sequence (164631 - 164680)	----+--------+--------+--------+--------+----* AAAAATAAGTGTATGAGTCTCATTCCATCCTAACAGCCTCTATTTTGGGG

Gene/Protein Characteristic Table for mKIAA1429

Features of the cloned DNA sequence

Features of the protein sequence