ROUGE

Gene/Protein Characteristic Table for mKIAA1324

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173149
Description :
Clone Name :	mid06020 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2739 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 224 bp

Genome contig ID gi65492966r_108153919
PolyA signal sequence
(AATATA,-26)
+----*----+----*----+----*----+----
AGCCTACCAAATATACCCACACTTCGTGTACTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCTTGCTTACATCTTGTTTTCTAAACACAGTCCACCCATGGGAGACTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1324 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1324	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 125..2515
Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE23958	100.0	unnamed protein...	Mus musculus
AAI66728	97.3	RGD1310209 prot...	Rattus norvegicus
XP_537043	90.9	similar to Y73F...	Canis lupus fam...
BAE01393	90.0	unnamed protein...	Macaca fascicularis
NP_065826	90.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	224 bp
Genome contig ID	gi65492966r_108153919
PolyA signal sequence (AATATA,-26)	+--------+--------+----*----+---- AGCCTACCAAATATACCCACACTTCGTGTACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCTTGCTTACATCTTGTTTTCTAAACACAGTCCACCCATGGGAGACTCA

Gene/Protein Characteristic Table for mKIAA1324

Features of the cloned DNA sequence

Features of the protein sequence