ROUGE

Gene/Protein Characteristic Table for mKIAA1289

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173143
Description :	baculoviral IAP repeat-containing 6. baculovirus inhibitor of apoptosis repeat containing ubiquitin-conjugating enzyme. apollon.
Clone Name :	mbg06118 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 259 bp

Genome contig ID gi65550231f_72319241
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCCGGCTATACAGAGAAACTCTGTCTCAAAAATCC
Flanking genome sequence
(129176 - 129225)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAATCTGAGAAAATCTTAACAAAGTAACTTGAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1289 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1289	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1032, 2176..4488
Length: 1115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL38438	99.5	baculoviral IAP...	Mus musculus
CAA76720	99.2	ubiquitin-conju...	Mus musculus
EDM02832	97.3	rCG62043 [Rattu...	Rattus norvegicus
XP_233842	97.3	similar to bacu...	Rattus norvegicus
XP_001065439	97.3	similar to bacu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 440 462 VLFLLSMDFTCHADLLLFVCKVL

Method	From	To	amino acid sequence
SOSUI	440	462	VLFLLSMDFTCHADLLLFVCKVL

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	259 bp
Genome contig ID	gi65550231f_72319241
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCGGCTATACAGAGAAACTCTGTCTCAAAAATCC
Flanking genome sequence (129176 - 129225)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAATCTGAGAAAATCTTAACAAAGTAACTTGAT

Gene/Protein Characteristic Table for mKIAA1289

Features of the cloned DNA sequence

Features of the protein sequence