ROUGE

Gene/Protein Characteristic Table for mKIAA1273

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173141
Description :	AAA-ATPase TOB3.
Clone Name :	mph00753 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3629 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2302 bp

Genome contig ID gi65493515r_154133003
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CCAGAATCGAATAAAACTGTGACTGATTTTCTGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTTGCTTGATGGCTGAGGTGGAGGGGCCTCAACCGCCCCTGGGGTTAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1273 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1273	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1306, 2805..3053
Length: 518 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q925I1	1.4e-122	86.3	ATPase family A...	Mus musculus
BAE42791	1.4e-122	86.3	unnamed protein...	Mus musculus
BAC36055	2.6e-122	86.1	unnamed protein...	Mus musculus
Q3KRE0	1.4e-121	84.9	ATPase family A...	Rattus norvegicus
XP_536708	3.4e-118	81.0	similar to AAA-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003959 360 517 PF00004 AAA ATPase

HMMSmart IPR003593 357 502 SM00382 AAA ATPase

ProfileScan NULL 92 179 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003959	360	517	PF00004	AAA ATPase
HMMSmart	IPR003593	357	502	SM00382	AAA ATPase
ProfileScan	NULL	92	179	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2302 bp
Genome contig ID	gi65493515r_154133003
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCAGAATCGAATAAAACTGTGACTGATTTTCTGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTGCTTGATGGCTGAGGTGGAGGGGCCTCAACCGCCCCTGGGGTTAGA

Gene/Protein Characteristic Table for mKIAA1273

Features of the cloned DNA sequence

Features of the protein sequence