ROUGE

Gene/Protein Characteristic Table for mKIAA1270

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173139
Description :
Clone Name :	mej00243 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2622 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1459 bp

Genome contig ID gi65550231f_42919840
PolyA signal sequence
(AATACA,-18)
+----*----+----*----+----*----+----
TACATGTGGTACACAATAATACAATAATTTGGTGT
Flanking genome sequence
(111664 - 111713)
----+----*----+----*----+----*----+----*----+----*
ATGTGTGTGTGTGTGTGTGTTTAAGTGTTTCACAAAGGATGGAAAGTTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1270 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1270	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1145, 1163..2230
Length: 736 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH79844	99.2	Aars2 protein [...	Mus musculus
Q14CH7	99.2	Probable alanyl...	Mus musculus
EDL23441	98.7	alanyl-tRNA syn...	Mus musculus
EDM18733	92.1	alanyl-tRNA syn...	Rattus norvegicus
XP_001253240	82.4	similar to alan...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002318 1 377 PF01411 Alanyl-tRNA synthetase

IPR012947 472 530 PF07973 Threonyl/alanyl tRNA synthetase

ProfileScan IPR002318 1 543 PS50860 Alanyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002318	1	377	PF01411	Alanyl-tRNA synthetase
IPR012947	472	530	PF07973	Threonyl/alanyl tRNA synthetase
ProfileScan	IPR002318	1	543	PS50860	Alanyl-tRNA synthetase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1459 bp
Genome contig ID	gi65550231f_42919840
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- TACATGTGGTACACAATAATACAATAATTTGGTGT
Flanking genome sequence (111664 - 111713)	----+--------+--------+--------+--------+----* ATGTGTGTGTGTGTGTGTGTTTAAGTGTTTCACAAAGGATGGAAAGTTCT

Gene/Protein Characteristic Table for mKIAA1270

Features of the cloned DNA sequence

Features of the protein sequence