ROUGE

Gene/Protein Characteristic Table for mKIAA1269

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129319
Description :	Glucocorticoid modulatory element binding protein 2 (Fragment).
Clone Name :	mbh02572 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4298 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2330 bp

Genome contig ID gi66880554r_180868411
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CTTGGTACTTTGATTTAAAATAAAAACACTTTTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTCGTGTGTTTGTCTCTTGTAATGAAAGCTATGAAGAAACCAAATTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1269 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1269	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 15..614, 1333..1968
Length: 411 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH29763	4.1e-141	99.5	Gmeb2 protein [...	Mus musculus
P58929	4.2e-141	99.5	Glucocorticoid ...	Mus musculus
EDL88736	4e-139	98.1	glucocorticoid ...	Rattus norvegicus
EDL88735	4.5e-139	98.1	glucocorticoid ...	Rattus norvegicus
O88873	6.6e-139	97.8	Glucocorticoid ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000770 1 44 PF01342 SAND

HMMSmart IPR000770 1 44 SM00258 SAND

ProfileScan IPR000770 1 44 PS50864 SAND

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000770	1	44	PF01342	SAND
HMMSmart	IPR000770	1	44	SM00258	SAND
ProfileScan	IPR000770	1	44	PS50864	SAND

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2330 bp
Genome contig ID	gi66880554r_180868411
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CTTGGTACTTTGATTTAAAATAAAAACACTTTTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCGTGTGTTTGTCTCTTGTAATGAAAGCTATGAAGAAACCAAATTTA

Gene/Protein Characteristic Table for mKIAA1269

Features of the cloned DNA sequence

Features of the protein sequence